Top » Catalog » E » A5604

$18.00

A5604
[A5604]

A5604
hg38 Position: ChrY:9287567..9287567
Ancestral: G
Derived: T
Reference: Hamma Bachir (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V13
Forward Primer: A5604_F GCAGATGTAATGGGTTGATACATG
Reverse Primer: A5604_R AAAAGACAGATAGCCAAGGAAGC
Reviews

Customers who bought this product also purchased
MZ236
MZ236
BY199425
BY199425
E Superclade Panel
E Superclade Panel
MZ182
MZ182
MZ260
MZ260
L335
L335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies