Top » Catalog » E » A5604

$18.00

A5604
[A5604]

A5604
hg38 Position: ChrY:9287567..9287567
Ancestral: G
Derived: T
Reference: Hamma Bachir (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V13
Forward Primer: A5604_F GCAGATGTAATGGGTTGATACATG
Reverse Primer: A5604_R AAAAGACAGATAGCCAAGGAAGC
Reviews

Customers who bought this product also purchased
Y136951
Y136951
M96
M96
Z21074
Z21074
M267
M267
L335
L335
M168
M168
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY153064
1 x BY2100
1 x ALK377
1 x MF50714
1 x Y15175
1 x Y47697
1 x A11814
1 x ALK567
1 x Y28530
1 x A11124
1 x A1151
1 x F4168
1 x Y15906
1 x Y13295
1 x BY6336
1 x Y44573
$288.00
Haplogroup Info
Other products
Currencies