Top » Catalog » E » A9055

$18.00

A9055
[A9055]

A9055
hg38 Position: ChrY:8673117..8673117
Ancestral: G
Derived: A
Reference: Frank Peel (2015)
ISOGG Haplogroup: E
Comments: .
Forward Primer: A9055_F TGGCTCCACCTCTTTCAAAC
Reverse Primer: A9055_R CAATCTGGAGTGCAGACAGC
Reviews

Customers who bought this product also purchased
A9056
A9056
A9059
A9059
A9058
A9058
A9057
A9057
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY10127
1 x BY5022
$36.00
Haplogroup Info
Other products
Currencies