Top » Catalog » E » A9059

$18.00

A9059
[A9059]

A9059
hg38 Position: ChrY:20750584..20750584
Ancestral: C
Derived: G
Reference: Frank Peel (2015)
ISOGG Haplogroup: E
Comments: .
Forward Primer: A9059_F CTAGGCACTGGGGACGTG
Reverse Primer: A9059_R GAGCCCAAAACTCAGATTCC
Reviews

Customers who bought this product also purchased
A9058
A9058
A9057
A9057
A9056
A9056
A9055
A9055
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies