Top » Catalog » E » A9714

$18.00

A9714
[A9714]

A9714
hg38 Position: ChrY:12616265..12616265
Ancestral: A
Derived: T
Reference: Denis Savard (2016)
ISOGG Haplogroup: E1b1b1b2a1a4d1a1~ (not listed)
Comments: Downstream of Y4970
Forward Primer: A9714_F CAGCAGATAGTGCTGCCAAG
Reverse Primer: A9714_R TGCTGGGGAAATAAGACCTG
Reviews

Customers who bought this product also purchased
Y4970
Y4970
E Superclade Panel
E Superclade Panel
E1b-Z834 Panel
E1b-Z834 Panel
Y6938
Y6938
Z834
Z834
Y2947
Y2947
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies