Top » Catalog » E » A9717

$18.00

A9717
[A9717]

A9717
hg38 Position: ChrY:16729154..16729154
Ancestral: C
Derived: T
Reference: Denis Savard (2016)
ISOGG Haplogroup: E
Comments: Downstream of Y4970
Forward Primer: A9717_F TACCCATTGTCGGGTAGTGTC
Reverse Primer: A9717_R GTAGCTGGGACTGCAAGTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY8338
1 x Y13675
1 x A15370
1 x Y137771
$72.00
Haplogroup Info
Other products
Currencies