Top » Catalog » E » A9887

$18.00

A9887
[A9887]

A9887
hg38 Position: ChrY:2818726..2818726
Ancestral: G
Derived: A
Reference: Denis Savard (2016)
ISOGG Haplogroup: E
Comments: Downstream of Y4970
Forward Primer: A9887_F CTTGAAATTGGGAGGCAGAG
Reverse Primer: A9887_R ACGGGATTTACCACGTTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x P222
$18.00
Haplogroup Info
Other products
Currencies