Top » Catalog » E » A9897

$18.00

A9897
[A9897]

A9897
hg38 Position: ChrY:16441130..16441130
Ancestral: A
Derived: C
Reference: Denis Savard (2016)
ISOGG Haplogroup: E
Comments: Downstream of Y4970
Forward Primer: A9897_F AGAAAGATGTGGCAACACATTG
Reverse Primer: A9897_R GTTAAATCAACACCTCATGAATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A20314
$18.00
Haplogroup Info
Other products
Currencies