Top » Catalog » E » A9900

$18.00

A9900
[A9900]

A9900
hg38 Position: ChrY:20909606..20909606
Ancestral: A
Derived: G
Reference: Denis Savard (2016)
ISOGG Haplogroup: E
Comments: Downstream of Y4970
Forward Primer: A9900_F ACCCAGACCCCTTAGACAGG
Reverse Primer: A9900_R CATCTCTCCCCCTTCTCTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies