Top » Catalog » E » CTS8411

$18.00

CTS8411
[CTS8411]

CTS8411
hg38 Position: ChrY:15873028..15873028
Ancestral: C
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V12 > CTS693 > CTS6667 > Y2873
Forward Primer: CTS8411_F AACATCACACTGGTGCATCAC
Reverse Primer: CTS8411_R GACTCACTTTCCAGGGGTTAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies