Top » Catalog » E » A12310

$18.00

A12310
[A12310]

A12310
hg38 Position: ChrY:22261099..22261099
Ancestral: A
Derived: G
Reference: Douglas Phelps (2016)
ISOGG Haplogroup: E
Comments: .
Forward Primer: A12310_F CAAGCTGCCGGATAGTATGG
Reverse Primer: A12310_R GGCCACTAAATCTGACATTGC
Reviews

Customers who bought this product also purchased
A12306
A12306
BY4136
BY4136
A12309
A12309
A12308
A12308
A12307
A12307
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies