Top » Catalog » E » A12282

$18.00

A12282
[A12282]

A12282
HG19 Position: ChrY:19295572..19295572
Ancestral: G
Derived: T
Reference: Douglas Phelps (2016)
ISOGG Haplogroup: E
Comments: .
Forward Primer: A12282_F AATGGAGAAAAGTGAATTAAACAAATG
Reverse Primer: A12282_R AGTTTTAACAATAGTCACCATCAAAACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1158
1 x FGC14092
$36.00
Haplogroup Info
Other products
Currencies