Top » Catalog » E » BY9972

$18.00

BY9972
[BY9972]

BY9972
hg38 Position: ChrY:14475966..14475966
Ancestral: G
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: Below L19 > A2227
Forward Primer: BY9972_F TCCAGGGAATGATATTTACTGAGAG
Reverse Primer: BY9972_R GGATACAAAATCAATCTAGGTGCC
Reviews

Customers who bought this product also purchased
M215
M215
E Superclade Panel
E Superclade Panel
Z834
Z834
V22
V22
V13
V13
L335
L335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies