Top » Catalog » E » A14039

$18.00

A14039
[A14039]

A14039
hg38 Position: ChrY:21185698..21185698
Ancestral: G
Derived: A
Reference: Igor Schein (2017)
ISOGG Haplogroup: E1b1b1b2a1a4d2b~ (not listed)
Comments: Downstream L971 _ Y4971 _ Y4975 _ Y6923 _ B405
Forward Primer: A14039_F ACACCCAGTGGAGTTCCTTG
Reverse Primer: A14039_R TCTTTCTGGCTCCTGCAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y13478
1 x BZ3322
1 x BZ2987
1 x Z27353
$72.00
Haplogroup Info
Other products
Currencies