Top » Catalog » E » A14040

$18.00

A14040
[A14040]

A14040
hg38 Position: ChrY:7971174..7971174
Ancestral: G
Derived: A
Reference: Igor Schein (2017)
ISOGG Haplogroup: E1b1b
Comments: Downstream L971 _ Y4971 _ Y4975 _ Y6923 _ B405
Forward Primer: A14040_F TCGCAATCTCAACAATGAGC
Reverse Primer: A14040_R TACCTGGCCCAATCCAGTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies