Top » Catalog » E » A14084

$18.00

A14084
[A14084]

A14084
hg38 Position: ChrY:20637902..20637902
Ancestral: G
Derived: T
Reference: Zachary Gordon (2017)
ISOGG Haplogroup: E
Comments: Below L791_Y6923_Y15561
Forward Primer: A14084_F TGTTCATCAAGAGAATTGGTCTG
Reverse Primer: A14084_R GCAAAACAAAGCATTCAAGG
Reviews

Customers who bought this product also purchased
A14083
A14083
A14081
A14081
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies