Top » Catalog » E » BY4461

$18.00

BY4461
[BY4461]

BY4461
hg38 Position: ChrY:18651305..18651305
Ancestral: G
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V13 > Z5016 > Z38456
Forward Primer: BY4461_F AACTACTGAACTTAGAGAACAGACAAGC
Reverse Primer: BY4461_R GCACAGCATATGAACTTCATCTATG
Reviews

Customers who bought this product also purchased
CDY
CDY
DYS390
DYS390
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
S3003
S3003
V13
V13
DYS607
DYS607
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x PH2350
$18.00
Haplogroup Info
Other products
Currencies