Top » Catalog » E » BY10073

$18.00

BY10073
[BY10073]

BY10073
hg38 Position: ChrY:17342822..17342822
Ancestral: G
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b (not listed)
Comments: Downstream of PF6789
Forward Primer: BY10073_F CAGGTTGTGTTGAATACACACGAG
Reverse Primer: BY10073_R ACTTATTTACTTTTCCACTCACTCTGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A23762
$18.00
Haplogroup Info
Other products
Currencies