Top » Catalog » E » BY9980

$18.00

BY9980
[BY9980]

BY9980
hg38 Position: ChrY:14279774..14279774
Ancestral: C
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1
Comments: .
Forward Primer: BY9980_F GGTCTCTAAGAGGGTTCTCTGCC
Reverse Primer: BY9980_R ATGCTACAGAGATGAGACATGAATG
Reviews

Customers who bought this product also purchased
M5043
M5043
L335
L335
M215
M215
E Superclade Panel
E Superclade Panel
Z834
Z834
V22
V22
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y4753
1 x A14041
$36.00
Haplogroup Info
Other products
Currencies