Top » Catalog » E » A14758

$18.00

A14758
[A14758]

A14758
hg38 Position: ChrY:17258271..17258271
Ancestral: C
Derived: T
Reference: Zachary Gordon (2017)
ISOGG Haplogroup: E
Comments: Below L791 _ Y6923 _ Y15936 _ Y15938
Forward Primer: A14758_F TCCATTTTTCATCTGCTTTCC
Reverse Primer: A14758_R GCATGCTTATTACATGGGGTTC
Reviews

Customers who bought this product also purchased
Y15938
Y15938
A14757
A14757
A14756
A14756
A14755
A14755
A14754
A14754
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies