Top » Catalog » E » A15197

$18.00

A15197
[A15197]

A15197
hg38 Position: ChrY:12571100..12571100
Ancestral: A
Derived: G
Reference: Stephen Goodrich (2017)
ISOGG Haplogroup: E
Comments: .
Forward Primer: A15197_F GAGCACCTCTCCTCCTTGAAG
Reverse Primer: A15197_R TTCAAGAAGTATCTTTGTGGCATTC
Reviews

Customers who bought this product also purchased
A15159
A15159
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies