Top » Catalog » E » A15645

$18.00

A15645
[A15645]

A15645
hg38 Position: ChrY:15656471..15656471
Ancestral: T
Derived: A
Reference: Hamma Bachir (2017)
ISOGG Haplogroup: E1b (not listed)
Comments: Downstream of FGC18960
Forward Primer: A15645_F AAGTGTGGTGGGTAGAATAACTCC
Reverse Primer: A15645_R CCAAGGGTGTTTATTACGCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x M1897
1 x CTS660
1 x CTS6778
1 x Y144153
1 x Y46207
$90.00
Haplogroup Info
Other products
Currencies