Top » Catalog » E » BY10300

$18.00

BY10300
[BY10300]

BY10300
hg38 Position: ChrY:16059656..16059656
Ancestral: A
Derived: G
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: .
Forward Primer: BY10300_F GGTAATGCTTCCGCTCTGTC
Reverse Primer: BY10300_R TTCCAAACTTGCACCTCTCC
Reviews

Customers who bought this product also purchased
BY10308
BY10308
BY10303
BY10303
BY10302
BY10302
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10927
$18.00
Haplogroup Info
Other products
Currencies