Top » Catalog » E » HU137

$18.00

HU137
[HU137]

HU137
hg38 Position: ChrY:19260472..19260472
Ancestral: T
Derived: A
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: E1b1b1a1b2a4b5b (not listed)
Comments: Below CTS508 > BY7250
Forward Primer: HU137_F TAGGCACATGGATGAAGCTG
Reverse Primer: HU137_R TGTTCAAGGCTGGGAATAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies