Top » Catalog » E » HU158

$18.00

HU158
[HU158]

HU158
hg38 Position: ChrY:19370285..19370285
Ancestral: C
Derived: T
Reference: Faleh Al Hujailan (2017)
ISOGG Haplogroup: E1b (not listed)
Comments: Approx. CTS194
Forward Primer: HU158_F ATCTGGTCCTTGGGAGATTC
Reverse Primer: HU158_R TCCAACATCACACCTCACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies