Top » Catalog » E » A16323

$18.00

A16323
[A16323]

A16323
hg38 Position: ChrY:19705576..19705576
Ancestral: A
Derived: C
Reference: Janet Akaha (2017)
ISOGG Haplogroup: E
Comments: Below BY8506
Forward Primer: A16323_F AATTTACCCTTCCCCACTGC
Reverse Primer: A16323_R ATCTTGAGGAAGCCCAAGTG
Reviews

Customers who bought this product also purchased
A16322
A16322
A16321
A16321
A16320
A16320
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK906
1 x BY8103
1 x CTS2214
1 x SK1512
1 x Y4706
1 x A1605
1 x Y13366
1 x A19282
1 x BY4637
1 x Y53789
1 x BY7446
1 x FGC58060
1 x ALK96
1 x FGC5906
1 x Y6569
$270.00
Haplogroup Info
Other products
Currencies