Top » Catalog » E » A16324

$18.00

A16324
[A16324]

A16324
hg38 Position: ChrY:7422944..7422944
Ancestral: C
Derived: T
Reference: Janet Akaha (2017)
ISOGG Haplogroup: E
Comments: Below BY8506
Forward Primer: A16324_F CCTTTGGGACAAAAATTCAGG
Reverse Primer: A16324_R TGTAGCCTGCAGTGACTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies