Top » Catalog » E » BY6865

$18.00

BY6865
[BY6865]

BY6865
hg38 Position: ChrY:16567916..16567916
Ancestral: T
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: E
Comments: .
Forward Primer: BY6865_F GGCATGTGTATGCATGTATTTATAAAC
Reverse Primer: BY6865_R TGCGTAAGATATTCAACACTTTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A20218
1 x BY20078
1 x BZ1307
$54.00
Haplogroup Info
Other products
Currencies