Top » Catalog » E » BY6865

$18.00

BY6865
[BY6865]

BY6865
hg38 Position: ChrY:16567916..16567916
Ancestral: T
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: E
Comments: .
Forward Primer: BY6865_F GGCATGTGTATGCATGTATTTATAAAC
Reverse Primer: BY6865_R TGCGTAAGATATTCAACACTTTCTG
Reviews

Customers who bought this product also purchased
Y16536
Y16536
Y35965
Y35965
PH2818
PH2818
BY7030
BY7030
Y16563
Y16563
Y33589
Y33589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies