Top » Catalog » E » A785

$18.00

A785
[A785]

A785
hg38 Position: ChrY:18964171..18964171
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: E1b1b1a1b1a6 (not listed)
Comments: Downstream L540
Forward Primer: A785_F CATTGTATTTCACTCTTTTCTCTTATAAGTG
Reverse Primer: A785_R TATATTTCACCTCAAAATAATAAACTAAGACG
Reviews

Customers who bought this product also purchased
A786
A786
A784
A784
A783
A783
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies