Top » Catalog » E » A16421

$18.00

A16421
[A16421]

A16421
hg38 Position: ChrY:8971276..8971276
Ancestral: G
Derived: A
Reference: Ilan Coleman (2017)
ISOGG Haplogroup: E1b1b
Comments: Below M84>Y5441>Y5427>Y14899>Y14891>Y16781>Y17357
Forward Primer: A16421_F ATGAGTGAGGATGGCAGAGG
Reverse Primer: A16421_R TAAATCCCAGGCCATCTTTG
Reviews

Customers who bought this product also purchased
A16425
A16425
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies