Top » Catalog » E » CTS1001

$18.00

CTS1001
[CTS1001]

CTS1001
hg38 Position: ChrY:7268178..7268178
Ancestral: A
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: E1b1a1a1a
Comments: Downstream V43; aka M4727
Forward Primer: CTS1001_F TCCTATTGTTGGATGCAGAGG
Reverse Primer: CTS1001_R TTGGGAGGCTCACGTAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies