Top » Catalog » E » FGC14574

$18.00

FGC14574
[FGC14574]

FGC14574
hg38 Position: ChrY:19097382..19097385
Ancestral: ins
Derived: del
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: E (not listed)
Comments: .
Forward Primer: FGC14574_F TTCTGCTGTGTGAGAATGCAG
Reverse Primer: FGC14574_R ACTTCTCCCTTCACACTCTCTCTG
Reviews

Customers who bought this product also purchased
Z5018
Z5018
Z16242
Z16242
L1019
L1019
E1b-L1019 Goodrich Panel
E1b-L1019 Goodrich Panel
FGC14567
FGC14567
YFS287725
YFS287725
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x CTS6454
1 x CTS8814
$36.00
Haplogroup Info
Other products
Currencies