Top » Catalog » E » A16694

$18.00

A16694
[A16694]

A16694
hg38 Position: ChrY:8990287..8990287
Ancestral: G
Derived: T
Reference: Igor Schein (2017)
ISOGG Haplogroup: E1b1b
Comments: Below M84>Y5441>Y5427>Y14899>Y14891>Y16781>Y18621
Forward Primer: A16694_F CTGGTGAGGTGTGGATTGTG
Reverse Primer: A16694_R TCCAGCCATTACAACGTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY15416
1 x Z27279
1 x BY7446
1 x BZ1548
1 x BY14150
1 x A11802
1 x Y12600
$126.00
Haplogroup Info
Other products
Currencies