Top » Catalog » E » BY11094

$18.00

BY11094
[BY11094]

BY11094
hg38 Position: ChrY:8332760..8332760
Ancestral: C
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b (not listed)
Comments: Below PF6747
Forward Primer: BY11094v2_F GCCTACTTGGAATATTTGGCTAATG
Reverse Primer: BY11094v2_R CCTTTTTTAGGCAGGGTCTAGAAG
Reviews

Customers who bought this product also purchased
BY1098
BY1098
BY10650
BY10650
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies