Top » Catalog » E » BY6870

$18.00

BY6870
[BY6870]

BY6870
hg38 Position: ChrY:9022749..9022749
Ancestral: G
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: E
Comments: Below V22 > CTS6080 > PH2818 > Y20406 > BY6865
Forward Primer: BY6870_F CCAGAATGCAGATGATAGAGGAG
Reverse Primer: BY6870_R GCCTGTGTGTGTGGCTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y67505
$18.00
Haplogroup Info
Other products
Currencies