Top » Catalog » E » A17837

$18.00

A17837
[A17837]

A17837
hg38 Position: ChrY:9585251..9585251
Ancestral: A
Derived: G
Reference: Igor Schein (2017)
ISOGG Haplogroup: E1b1b1b2a1a4d2b
Comments: Downstream B405
Forward Primer: A17837_F CGGCGAATAACATTGAACATC
Reverse Primer: A17837_R TCAAGCAATTCTCCCACCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC5943
$18.00
Haplogroup Info
Other products
Currencies