Top » Catalog » E » A17835

$18.00

A17835
[A17835]

A17835
hg38 Position: ChrY:8050937..8050937
Ancestral: C
Derived: T
Reference: Hamma Bachir (2017)
ISOGG Haplogroup: E1b (not listed)
Comments: Downstream of PF2428
Forward Primer: A17835_F TGTTGGGCTCAGATAATGAGG
Reverse Primer: A17835_R ACACTGGAGCAAACCTGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A14084
$18.00
Haplogroup Info
Other products
Currencies