Top » Catalog » E » A18013

$18.00

A18013
[A18013]

A18013
hg38 Position: ChrY:21285417..21285417
Ancestral: T
Derived: C
Reference: Douglas Phelps (2017)
ISOGG Haplogroup: E
Comments: Below M44
Forward Primer: A18013_F TTTAAATCTTTTGCCCATTCTG
Reverse Primer: A18013_R TGTACCTCCGGGAGAATTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies