Top » Catalog » E » BY20366

$18.00

BY20366
[BY20366]

BY20366
hg38 Position: ChrY:18927820..18927820
Ancestral: T
Derived: C
Reference: FTDNA (2017)
ISOGG Haplogroup: E
Comments: Below Y14891
Forward Primer: BY20366_F ACTTGCCAACATGGGAAGAG
Reverse Primer: BY20366_R TCATCAGTGTTTTGTCTCCTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY4463
1 x BY5650
1 x BZ1268
1 x A13143
1 x Page36
1 x A12499
1 x Z31522
$126.00
Haplogroup Info
Other products
Currencies