Top » Catalog » E » A16862

$18.00

A16862
[A16862]

A16862
hg38 Position: ChrY:19514919..19514919
Ancestral: G
Derived: A
Reference: Vincent Tilroe (2017)
ISOGG Haplogroup: E1b1b1b2b3b1a~
Comments: Below E-Y23671. Aka Z621
Forward Primer: A16862_F AACCAAGGGAATTCATGAGG
Reverse Primer: A16862_R CCAGCCTCCTTAGCACTGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies