Top » Catalog » E » BY4914

$18.00

BY4914
[BY4914]

BY4914
hg38 Position: ChrY:14254618..14254618
Ancestral: C
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1b1a1b1a10b (not listed)
Comments: Below FGC11457
Forward Primer: BY4914_F GGCATGAACCCAGGAGATG
Reverse Primer: BY4914_R GTCTATCTGGGCCATTTTGC
Reviews

Customers who bought this product also purchased
E1b-V13 Panel
E1b-V13 Panel
L241
L241
Z16659
Z16659
A9479
A9479
S2979
S2979
FGC11451
FGC11451
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies