Top » Catalog » E » BY10200

$18.00

BY10200
[BY10200]

BY10200
hg38 Position: ChrY:13405374..13405374
Ancestral: A
Derived: C
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: Aka FGC22835. Below M81 > L351
Forward Primer: BY10200_F TCGCTTAAAGCTGAAGTTTCC
Reverse Primer: BY10200_R CATTGGGTAGCGATCACATC
Reviews

Customers who bought this product also purchased
BY10206
BY10206
BY10204
BY10204
BY10203
BY10203
BY10201
BY10201
FGC22840
FGC22840
BY10209
BY10209
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies