Top » Catalog » E » BY11344

$18.00

BY11344
[BY11344]

BY11344
hg38 Position: ChrY:8827716..8827716
Ancestral: C
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: Below V22 > FGC37181
Forward Primer: BY11344_F GCTCTGAAGCCAAATACGTGG
Reverse Primer: BY11344_R GAGATGGGGTTTCATCATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies