Top » Catalog » E » A19388

$18.00

A19388
[A19388]

A19388
hg38 Position: ChrY:8494485..8494485
Ancestral: T
Derived: C
Reference: Igor Schein (2017)
ISOGG Haplogroup: E1b1b1b2a1a1a1b2b1
Comments: Downstream A12313
Forward Primer: A19388vl_F GGACTTTTACAGTGGGAGAATTG
Reverse Primer: A19388vl_R CCTCAAAACTAAGCTTTGTAAATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies