Top » Catalog » E » BY4467

$18.00

BY4467
[BY4467]

BY4467
hg38 Position: ChrY:12658382..12658382
Ancestral: A
Derived: G
Reference: Oliver Rakonjac (2017)
ISOGG Haplogroup: E
Comments: CTS9320 > Z17107
Forward Primer: BY4467_F CAGGTGTGAGCCATCACG
Reverse Primer: BY4467_R TGGCATAAGAAATGGGGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies