Top » Catalog » E » A20218

$18.00

A20218
[A20218]

A20218
hg38 Position: ChrY:21449361..21449361
Ancestral: A
Derived: G
Reference: Igor Schein (2017)
ISOGG Haplogroup: E1b1b1b2a1a1a1b2b1
Comments: Downstream Y18621
Forward Primer: A20218_F CAACTGTGGGTGCAGGAAC
Reverse Primer: A20218_R GTTCCCTGCAGTGCTAATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies