Top » Catalog » E » A20314

$18.00

A20314
[A20314]

A20314
hg38 Position: ChrY:15360487..15360487
Ancestral: G
Derived: A
Reference: Yacine Kemouche (2018)
ISOGG Haplogroup: E
Comments: .
Forward Primer: A20314_F CCCCTTGCAGAGAATGACTG
Reverse Primer: A20314_R GTTACCTCATGACAACAACCCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies