Top » Catalog » E » A20729

$18.00

A20729
[A20729]

A20729
hg38 Position: ChrY:20952654..20952654
Ancestral: G
Derived: A
Reference: Igor Schein (2018)
ISOGG Haplogroup: E1b1b1b2a1a1a1b2b1
Comments: Downstream A12313
Forward Primer: A20729_F GAGCCCTGAGACTCAAATGG
Reverse Primer: A20729_R GAGGTTAACCAAAACCACTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies