Top » Catalog » E » A20853

$18.00

A20853
[A20853]

A20853
hg38 Position: ChrY:19155205..19155205
Ancestral: A
Derived: C
Reference: Igor Schein (2018)
ISOGG Haplogroup: E1b1b1b2a1a1a1b2b2
Comments: Downstream Y17357
Forward Primer: A20853_F CATGCCTGTAGTCCCAGGAG
Reverse Primer: A20853_R GAAGTCCAACTGGCTTCACC
Reviews

Customers who bought this product also purchased
A20852
A20852
A20851
A20851
A20850
A20850
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies