Top » Catalog » E » FGC61652

$18.00

FGC61652
[FGC61652]

FGC61652
hg38 Position: ChrY:19130834..19130834
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: E1b
Comments: .
Forward Primer: FGC61652_F CATTTGGCAATTACTGGAAATCTG
Reverse Primer: FGC61652_R GCCATTACCAATTGAATGCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies