Top » Catalog » E » A931

$18.00

A931
[A931]

A931
hg38 Position: ChrY:14965963..14965963
Ancestral: G
Derived: C
Reference: Hamma Bachir (2014)
ISOGG Haplogroup: E (not listed)
Comments: .
Forward Primer: A931_F ATCCTGCACATGTGCCAC
Reverse Primer: A931_R AATCAGAGATAATGTCACATTGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies